CHAPTER 17
Primer Designing – Basics
CS Mukhopadhyay and RK Choudhary
School of Animal Biotechnology, GADVASU, Ludhiana
17.1 INTRODUCTION
A primer is a short synthetic oligonucleotide, which is used to initiate amplification of DNA/RNA in a polymerase chain reaction (PCR). Literally, “to prime” means to “initiate” or “start”. In vivo, a short oligo‐sequence (i.e., the primer) is required, because the enzyme “DNA polymerase” has no capacity to initiate DNA replication without any primer. During this process of molecular photocopying, in vitro amplification of the target nucleotide sequence is initiated by a short complementary oligo.
Specificity and efficiency are two important factors for designing primers. Specificity of a primer pair is the ability of a PCR primer pair to amplify a specific product (i.e., no spurious amplification). The length and sequence of the oligo‐sequence pattern (repetitive or single copy, part of a multi‐gene family) of the template are factors that affect the specificity of primers. The efficiency of a primer pair refers to the fold increase of amplicon in each cycle, which should be ideally two folds in each cycle (practically, between 1.8 and 1.95).
17.2 OTHER IMPORTANT FEATURES FOR DESIGNING “GOOD” PRIMERS
17.2.1 Adding RE sites to primers
Restriction endonuclease (RE) site (4–6 nucleotides) is added at the 5′‐terminus of the oligo to use the amplicon in cloning and genetic engineering. Add 2–3 more bases before this RE site to facilitate the RE to attach to the sequence. Two different set of Tms – namely, for the core primer (18 nt long) and whole primer (18 + 4 or 6 bases) – are to be considered. The Tm should not differ much for these two sets.
TABLE 17.1 Important parameters to be considered for designing “good” primers (http://www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html).
| SN | Feature | Ideal value or range | Pros | Cons |
| 1 | Primer length | 18–25 nucleotides (nt). | Too short primers show low specificity, while very long primers reduce template‐binding efficiency due to formation of secondary structures, and also require more time to anneal and denature. | Primers for multiplexing may be as long as 30–35 bp, while primers used for random priming (e.g., RAPD) are kept short, e.g., 8 (octamers) to 12‐mer, to promote random priming. |
| 2 | Melting temperature (Tm) | Mean annealing temperature is 5 °C less than the average Tm of the primer pair. | Tm refers to the temperature at which half proportion (or 50%) of the primer and its complementary nucleotides of the template are hybridized. | A primer should anneal to the template before the template strands re‐nature. |
| 3 | Optimal Tm | 52–62 °C. | Tm below 45 °C could encourage secondary annealing and spurious amplification. If Tm > 65–70 °C of the primers for automated sequencing, secondary priming artifacts, and noisy amplicons are evident. | Higher Tm (75–80 °C) is recommended for amplifying high G/C content of targets |
| 4 | Primer pair Tm mismatch | Ideal 2 °C; at most, 5 °C. | Out of the primer pairs, the primer which has more Tm will misprime at lower temperatures, while the other primer may not anneal to template at higher temperatures. | – |
| 5 | Cross‐homology | No cross‐homology within the same species. | Mispriming will result. | Primer‐BLAST checks possible spurious amplifications. Exon‐exon junctions of complementary DNA strand (CDS) should be targeted to amplify mRNA/cDNA (genomic DNA will not be amplified). |
| 6 | Primer G/C content | Optimum is 45–55%. | Can vary between 40 and 60%. | This determines the annealing temperature. |
| 7 | G/C Clamp | 2 G/C within the last four bases at 3’ end of primer. | Three or more G/C clamps could make the primer “sticky”, due to higher Tm at 3’ terminus | 3’‐terminus of the primer is crucial. G/C at 3’‐end increases the efficiency of the primers. |
| 8 | Stretches of nucleotides | Max. of four dinucleotides or four mono‐nucleotide repeats in a primer. | Runs of same bases increase the probability of primer‐dimer and hairpin loop formation. | Could lead to annealing of primer(s) to an unintended template, due to chance similarity between complementary sequences that leads to low Gibb’s free energy at the 3’‐end. |
| 9 | Optimal amplicon size | SSCP: < 400 nucleotide; cloning: 200‐ several kilobases (kb); Real time‐ qPCR: 80–200 bp; RFLP studies: variable. | In real‐time qPCR, amplicon size < 200 increases amplification efficiency close to 100%. | The length of the product is determined by the purpose of the experiment, rather than the rules for designing “good” primers. |
17.2.2 Secondary structures in primers
Secondary structures are the various combinations of the primers formed among themselves (self and heterologous) via a loop‐like structure produced by the same primer.
- Hairpins: these are formed due to intra‐molecular interactions among the nucleotides of the same primer.
- Self‐dimer (homodimer): these dimers are formed by intermolecular interactions between two primers that are the same.
- Cross‐dimer (hetero‐dimer): produced by inter‐molecular interactions between the forward and reverse primers.
17.2.3 Max 3’‐end stability
Higher 3′‐end stability improves priming efficiency; however, increased 3′‐stability can inversely influence the specificity of primer, because 3′‐terminal partial hybridization induces non‐specific extension. It is rendered by the maximum ΔG of the 3′‐end.
17.2.4 Analyzing Gibbs free energy (Delta G)
The “Gibbs Free Energy” (ΔG) measures the quantity of work yielded by a process or system that is operational at a steady pressure. A higher absolute value, however, with a negative symbol, indicates the spontaneity of the reaction. In other words, a ΔG value of –9 signifies that the oligo and the template will anneal more spontaneously than another oligo which has ΔG = –5 kcal/mol. Thus, the former primer will require more energy to be dissociated or denatured than the second one. Therefore, ΔG is the amount of energy that can break a particular secondary structure, which is why the ΔG value is recommended to be less (absolute value) for the secondary structures than the primer‐template duplex. The ΔG values of the primers can be estimated using software such as “IDT Oligo Analyzer” online (http://eu.idtdna.com/analyzer/applications/oligoanalyzer/) for the 3′ ends of each of the oligos of the homo‐ and hetero‐dimers.
TABLE 17.2 The acceptable values of Gibb’s free energy for various secondary structures of primer (http://ls23l.lscore.ucla.edu/Primer3/primer3web_help.htm).
| SN | Secondary structures | Acceptable ΔG |
| 1 | 3’‐end hairpin | > –2 kcal/mol |
| 2 | Internal hairpin | > –3 kcal/mol |
| 3 | 3’‐end self‐dimer | > –5 kcal/mol |
| 4 | Internal self‐dimers | > –6 kcal/mol |
| 5 | 3’‐end cross‐dimer | > –5 kcal/mol |
| 6 | Internal cross‐dimer | > –6 kcal/mol |
| 7 | 5 bases from the 3’‐end of primers | > = –9 kcal/mol |
17.3 QUESTIONS
- 1. Suppose you have designed a primer of 21 bases, which is as follows: 5′ ACGTAGCTATGGCAATGTAAT 3′. Enumerate what are the parameters that are not optimum in this primer.
- 2. The ΔG value of the 3′‐end dimer of a given primer is –8 kcal/mol. Explain your logic as to the acceptability of this primer.
- 3. Enlist the main parameters, along with the optimum values, that are used for evaluation of a designed primer.
- 4. What do you mean by secondary structure? How are these formed? What are the implications of secondary structure formation during PCR amplification?