CHAPTER 18
Designing PCR Primers Using the Primer3 Online Tool

CS Mukhopadhyay and RK Choudhary

School of Animal Biotechnology, GADVASU, Ludhiana

18.1 INTRODUCTION

The previous chapter (Chapter 17) discussed in brief the salient features of PCR‐primers. Here we will learn how to use Primer3, an online software tool, for designing PCR primers.

18.2 OBJECTIVE

To design primers for bubaline Dicer I cds, using the online primer designing tool Primer3.

18.3 PROCEDURE

18.3.1 Downloading a nucleotide sequence

Type the URL (www.ncbi.nlm.nih.gov/) to open the NCBI home page. Search the required nucleotide sequence, select the target sequence from NCBI nucleotide and save it in FASTA format in a text file.

18.3.2 Open Primer3 online tool

Open the Primer3 (version 4) software by using the URL http://primer3.ut.ee/.

18.3.3 Obtaining nucleotide sequence of interest

Paste the nucleotide sequence (in FASTA format) in the box for source sequence in the Primer3 page.

Parameters of the Primer3 online tool for primer designing, displaying 3 arrows pointing to the sequence bar, Pick left primer, or use left primer below, and pick right primer, or use right primer below.

FIGURE 18.1 Setting the parameters of the Primer3 online tool for primer designing.

18.3.4 Set the required parameters

All the parameters mentioned on the Primer3 page have been explained, along with the optimal values, in Table 18.1.

TABLE 18.1 Primer3 parameters, description and their optimal values/options (http://ls23l.lscore.ucla.edu/Primer3/primer3web_help.htm).

SN Parameter Description Optimal value
1 Library (repeat library) Allows the user to screen the databases (called libraries) for reported repeat sequences in human (microsatellite), rodents (VNTRs) and Drosophila (VNTRs) to skip the interspersed repeats as the location of primer(s). If the nucleotide sequence belongs to human, or rodents, Drosophila, select that species from the drop‐down menu; else select “None”.
2 Source sequence The nucleotide sequence from which the primers are to be designed should be in FASTA or EMBL format. Avoid repeat sequences, unless primer is being designed for microsatellites.
3 Pick left primer, or use left primer below Check the small box to get the left primer designed by Primer3. One can also paste the left (i.e., forward) primer in the rectangular sequence box, if the user wants to use the specified primer only. If a specific left primer is to be used, insert the sequence in the given space; else tick the check box on the left.
4 Pick hybridization probe (internal oligo), or use oligo below The software will choose a probe for the sequence given; else, we can put our own probe in the space below. If we do not need any probe, the check box is left unchecked. Same as “Pick left primer” given above. This option is left unchecked if probe is not required.
5 Pick right primer, or use right primer below Same as “Pick left primer”; this option is used for the right primer. –
6 Sequence ID This is an identifier or tag for the sequence given as input that is specified in the Primer3 output. Specify one name for the sequence as the ID of the sequence.
7 Targets Target means a specific nucleotide sequence (e.g., simple repeat sequence/base pair polymorphism) within the input/source sequence that is to be flanked by the designed primer‐pairs. More than one target(s) can also be specified. The syntax of mentioning the targets is using a space delimited list of START, LENGTH. START indicates the start of the target, while LENGTH specifies the length of the target. Mention the target(s) in the space separated START, LENGTH syntax if any specific target is to be flanked by the primers; else leave this parameter blank.
The target regions are specified by asterisks (*) in the Primer3 output.
Multiple targets can be specified as START1, LENGTH1 START2, LENGTH2.
 8 Excluded regions The portion(s) of nucleotide in the source sequence that must be excluded while designing primers by the software. The Primer3 will just skip those excluded regions and primers will not flank those specified regions. The syntax is same as for Targets, i.e., mention space separated list of START, LENGTH of the excluded regions. Do not put comma between the values of different sets of START and LENGTH. To exclude regions of “low sequence quality” or repeat sequences, specify the base locations as space‐separated list of START, LENGTH of those excluded regions. Otherwise, the parameter should be left blank. The excluded regions are specified by ”X” markings in the Primer3 output.
 9 Product size ranges This is the desired amplicon length or the product size we need in our wet lab. A list of ranges has been specified in the software, but any other set of ranges can be specified. User needs to specify one or more ranges, which will be considered during primer designing, starting from lower ranges to higher ranges specified (if the lower range does not succeed in picking primers, the software shifts to the next higher range). Specify one or more ranges as comma separated ranges, e.g., 80–100, 201–300. If the user skips this option, Primer3 will automatically screen ranges from the lower to higher side to pick primers.
10 Number to return It specifies the number of primer pairs to be returned by Primer3. The time required to design the primers is proportional to the number of primers returned. By default, the number of return is 5. This may be changed if good primers are not obtained in the first round, or we need to screen for another set of alternative primers.
11 Max 3’ stability The “Max 3’ stability” parameter estimates the maximum stability for the five terminal bases at the 3’‐end of the primer. More value (ignoring sign) means more stable 3’‐ends. The ΔG ranges between 6.86 (i.e., the highest for “GCGCG”) and 0.86 kcal/mol (the lowest for “TATAT”) for the 3’‐pentamers (SantaLucia, 1998). The value is calculated using the Nearest‐Neighbor parameter for the maximum ΔG to denature the 3’‐pentamers. Default value is 9.0 (it is not the ΔG), which is the maximum recommended value. The value can be kept unchanged; however, if the software fails to design the primers, the values may be reduced. Reducing the value of “Max 3’ Stability” simply compromises the efficiency of the primers.
12 Max repeat mispriming This parameter limits the maximum extent of mispriming due to the repeat sequence, based on the weighted similarity in the mispriming library. The higher the value set for the parameter, the lower the probability of mispriming – hence, the less the weighted similarity with any repeat sequence in the database. Default value: 12. Keep the value as default value. The libraries mentioned in the drop‐down list of “Library (repeat library)” (i.e., human, rodents and Drosophila) can only be screened for similarity with repeat sequences for mispriming.
13 Pair max mispriming Principally, this parameter is the same as the previous one; however, it calculates the weighted similarity for both the primers (sense and antisense) jointly. Default value: 24. Set the value to 24. Applicable for primers to be designed for human, rodents and Drosophila.
14 Max template mispriming This parameter estimates the probability of mispriming on a different location of the same template for each of the primers individually. Default value: 12
Keep the value as default value.
15 Pair Max Template Mispriming The scores of “Max Template Mispriming” for both the primers (forward and reverse) are summed up. It estimates the likelihood that both the primers will also anneal to the template provided on a different location. Default value: 24. Use the default value.
General primer picking conditions
16 Primer size The primer length optimally ranges between 18 and 25 bp; however, for multiplexing the primer length may increase up to 30–35 bp. Allowed range of values are 1 (minimum) and 36 (maximum) for the number of bases in a primer. Enter the number of bases (bp) as given:
Minimum size: 20
Optimum: 23
Maximum: 25
17 Primer Tm The melting temperature (Tm) value can ideally range between 52–62 °C. The software follows the primer‐Tm formula and the thermodynamic parameters are obtained from the table given by Breslauer et al. (1986). Enter the Tm as given (for normal primer):
Minimum Tm: 50 °C
Optimum Tm: Between 55 and 60 °C
Maximum: 65 °C.
18 Maximum Tm difference Wider Tm values for the primers lead to less efficiency of primers and mispriming. Set the value to 2 °C. If required to increase the difference, the highest allowed Tm difference is normally 5 °C.
19 Table of thermo‐dynamic parameters The Nearest‐Neighbor thermodynamic parameters, as well as the method to calculate the Tm, can be obtained from any one of the two following sources: Breslauer et al. (1986) and Santa Lucia (1998). Click on the drop‐down menu and select “Santa Lucia 1998”. The recommended option is “Santa Lucia 1998”.
20 Product Tm Product Tm refers to the temperature at which 50% of the amplified product remains single‐stranded. Lower product Tm will denature the template too early; it also signifies high A/T content. Again, too high product Tm will complicate the PCR, due to the requirement of more time to denature the template which, in turn, may affect the functionality of Taq polymerase. It is recommended to select the product Tm to 50 °C. Enter the product Tm as:
Minimum: 45 °C
Optimum: 50 °C
Maximum: 55 °C.
21 Primer GC% The G/C content of primer determines its Tm. Ideally, 50–65% G/C works well to maintain the efficiency of the designed primers. Enter the G/C% as:
Minimum: 35
Optimum: 65
Maximum: 80.
22 Max self‐complementary Primers with self‐complementarity produces homodimer and hairpin loop structures that hinder the annealing of primers with the complementary sequence. Non‐negative scores are assigned to the primers, based on the extent of local alignment between the sequences of the same primers. Initially set the value to 3.00. If it does not yield primer sequences, increase by 1 for each iteration of Primer3 run.
23 Max 3’ self‐complementary The 3’ terminus of the primer is very critical. Self‐complementarity at the 3’ end of any of the primer will thwart it from extending the template DNA during PCR. The terminal 3 bases should be strictly non‐complementary either to self or to the other primer. Initially set the value to 3.00. Gradually increase the score by 1 in each run of the Primer3 software, if required.
24 Max #N It is the number of maximal allowable unknown nucleotides in the flanked region to be primed. The “N” stands as a place‐holder for any of the bases. The Ns may increase the possibility of mispriming. Set the value to 0. However, sometimes it becomes challenging to exclude the Ns, especially in a novel cDNA sequence. In such cases, it may be increased to 1 or 2.
25 Max poly‐X: This option mentions the maximum number of allowable mononucleotide repeats in the primer. Long single‐base repeats can promote mispriming. Runs of 3 or more G/Cs or A/Ts at the 3’ terminus of primer should be avoided. Default is 5.
Set the value to 3.
26 Inside target penalty This parameter is very useful if a specific target (e.g., a gap junction) is to be overlapped. Thus, this option allows the software to select a primer that overlaps with the target. The default value is “BLANK”. The only two non‐default values, (i.e., 0 and 1) are allowed to penalize the primer that spans or overlaps the single target (dual targets are not possible to be overlapped simultaneously or by two different primers, according to the code written for Primer3), by multiplying the value assigned (0 or 1) with base‐counts of the primer overlapping the target. Default value is “blank”.
Set the value to “0” (if no target is there), or “1” (if a single target is to be overlapped).
27 Outside target penalty It is just the opposite of the above, where the software awards penalty to the primer that does not overlap the target. The chosen value (0 or 1) is multiplied by the number of bases from the 3' terminus of oligo to the target for obtaining the 'position penalty'. Thus this parameter enables us to reach to the target. Default value is “0”.
Set the value to “0” (if no target is there), or “1” (if proximity to a single target is to be considered).
28 First base index This refers to the key or index of the initial base in the source (i.e., input) sequence. This option informs Primer3 about the type of indexing of the initial base in the source sequence. GenBank (NCBI) uses one‐based indexing. Default index is “1”.
Set to “1”.
29 GC clamp This refers to the number of the G/Cs at the 3’ end of both the primers. 1 or 2 G/C clamp(s) (no more than that) is/are recommended in the 3’‐pentamers for each primer.
This parameter does not introduce G/C clamp in the hybridization probe. 		Default: 0.
Set: Default works fine; however, it can be increased to 1 or 2, if required.
30 Concentration of monovalent cations The concentration of monovalent salt (KCl) in mM in PCR master‐mix for calculating the Tm of the primers. Default: 50 mM.
Set to default.
31 Concentration of divalent cations The concentration of MgCl2 is required, as it has an immense effect on primer annealing and the net output of the PCR. Primer3 converts this to monovalent cation concentration for calculating the primer Tm. The concentration of deoxynucleotide triphosphate (dNTP) must be less than the concentration of divalent cations; otherwise, excess of dNTPs may chelate with MgCl2 and, thereby, hinder the progress of PCR. Default is 0.
Set to default, unless it is required to increase, as in the case of SYBR green primer designing, which requires approximately 3 mM MgCl2.
32 Concentration of dNTPs This refers to concentration of dNTPs in the PCR master mix in mM. Default: 0.
When the concentration of divalent cations (e.g., Mg2+) is provided, then only this argument is to be used.
33 Annealing oligo concentration Stands for the concentration of primers (nM) in the polymerase chain reaction. The software uses this argument to calculate primer Tm. Default: 50 nM
Set to default.
34 Liberal base This enables the Primer3 to accept any unrecognized bases (characters other than A/T/G/C), even symbols like “*” and “–”, by changing the base to “N”. To make this parameter work, the parameter “Max #N’s” must be set to a non‐0 value. It is better to click on the check box. However, this will only work if the parameter “Max #N’s” is set to a positive value.
Default is “checked”.
35 Show debugging information Checking this parameter will include the input to Primer3‐core as a part of the output. Default: Unchecked.
Depends on user’s requirement.
36 Do not treat ambiguity codes in libraries as consensus This is an instruction (self‐explanatory) to the software, and applicable to the species mentioned in the list of the mispriming libraries. Default: Checked.
37 Lower‐case masking Lower‐case letters signify the low‐complexity regions, i.e., the repeat region which, when present in the 3’ terminus of the primer, may negatively impact on the primer efficiency and annealing ability. Hence, when this parameter is checked, lower‐case letters are deleted from the 3’ end of the primers. Default: Unchecked
Check the box, if it is required.
Other per‐sequence inputs
38 Included region We may need to exclude some sequences, such as repeat sequence, vector sequence, signaling region, or the untranslated regions. This parameter specifies the region in the source‐sequence to include for designing primers. The syntax is START LENGTH. The START is the base from which the Primer3 software will look for suitable primers, and the LENGTH signifies the end of the region of choice. Set the value as per requirement; else leave blank.
39 Start codon position The parameter is very useful, but requires expertise to select an in‐frame amplicon. Any positive value will mark the start of “ATG” (i.e., the default start codon) in the sequence at that specified base onwards. An error will be pinged if there is no “ATG” at the specified location of the source sequence. A negative value indicates that the “ATG” sequence is upstream to the start of the source code, while a value less than or equal to 10–6 commands Primer3 to ignore this parameter. Set the value according to the position of the start codon; else leave the parameter blank.
40 Sequence quality
  • “Min Sequence Quality”
  • “Min 3' Sequence Quality”
  • “Sequence Quality Range Min”
  • “Sequence Quality Range Max”

The parameter indicates the quality of the source sequence. Each base should represent only one integer. A higher value of integer indicates higher confidence for base‐calling of the source‐sequence.
The parameters under “Sequence Quality” are considered only when quality values are assigned to each of the base. 		Default: Blank (for Sequence Quality).
It is better to leave this blank unless we are confident enough about the quality of the source sequence, and that primers will work on the template, having exactly the same sequence as the source.
41 Objective function penalty weights for primers and primer‐pairs In a nutshell, this argument assigns weights to each of the parameters required to qualify a primer, as per the user’s requirement. The software takes care of the weights while designing primers. The users can change the weights as per their own discretion (based on the use of primers). The default values are set in the software. It is better to change the weights after gaining adequate experience in primer designing. This is a very powerful parameter to select the best primers. If no weight is given, Primer3 will use the values as fed by the user at the beginning (i.e., “General primer picking conditions”).
42 HybOligo (internal oligo) per‐sequence inputs This parameter is very important for selecting the hybridization oligos (i.e., the probe). These parameters work similarly to the parameters for primers.
However, the parameter “Max 3' Complementarity” is an exception, since it cannot be applied for internal probes which do not produce primer‐dimer. 		Specify the parameters as per requirement.
Set the value of “Max 3' Complementarity” to 24.

All the parameters are not necessarily equally important. The experience of the user will cultivate a discretionary ability to select the parameters and set the optimal values. However, the parameters mentioned in the “General Primer Picking Conditions” section (Primer Size, Primer Tm, Maximum Tm difference, Primer GC%, Maximumselfcomplementary and Max 3′ Self‐Complementary) must be set, or else the software will design a set of primers on its default values for the parameters.

18.3.5 Get the primers

Finally, click on the “Pick Primers” option to get the primers. If any mistake has been made while setting the parameters, the “Reset Form” button should be clicked to initiate the parameter‐setting afresh.

18.4 OUTPUT

  1. Primer3 gives more than one set of primers (based on the number set for the “Number to Return” parameter).
  2. The primers are to be critically evaluated for various parameters, including product size and the target covered, as well as other parameters:
    1. Start: There are two start values – one for each of the primers in the pair. These refer to the index value of the starting base of the amplicon (for Forward primer) and the last base (for Reverse primer) nucleotide on the input (i.e., target) sequence on which the forward primer or the reverse primers bind.
    2. Length (given as “len”): Length of each primer.
    3. Tm(given as “tm”): Tm differences and GC%, for each oligo of the primer‐pair,
    4. Self‐complementarity (cited as “any” in the output): A value less than or equaling 3 indicates that the homodimer and hairpin structures produced by the particular primer can be tolerated during amplification. Higher values of self‐complementarity suggest that the secondary structure formed by the primer will require more energy (dissociation temperature) to dissociate. This could hinder the efficiency of the PCR.
    5. 3′ self‐complementary (cited as “3” in the output): This parameter is critical, as the 3′ end of the primer should be able to dissociate during denaturation and, again, the clamping of the 3′ end should be correct to effect efficient amplification. The permitted value of this parameter is 3 or less.
  3. Next, the primers are to be tested for the secondary structure formation using “IDT Oligo Analyzer” online software (http://eu.idtdna.com; click “Tool”, and then click “OligoAnalyzer”).
No alt text required.

FIGURE 18.2 Output page of Primer3 online tool, displaying one pair of primers and their position in the input target sequence (asterisks below the bases).

18.5 SELECTION OF THE BEST PRIMER‐PAIRS BY COMPARATIVE EVALUATION OF THE DESIGNED PRIMERS

The Primer3 software will give some (by default five pairs of oligos) primer pairs, from which the user needs to select the best pair for custom synthesizing (Table 18.2).

TABLE 18.2 Important parameters based on which primer is selected.

SN Feature Normal PCR Multiplexing
1 Primer length 18–25 nucleotide (nt) 30–35 nt
2 Optimal Tm 50–60 50–65: No much difference between various primer pairs
3 Primer G/C content Optimum is 45–55% 45–55: The primer pairs should not vary much among themselves for the average G/C content
4 3’ stability of primers ΔG > = –9 kcal/mol
Primer3 value = 9 		ΔG > = –8 kcal/mol
Primer3 value > 7
5 Self complementarity Primer3 value < = 3 Primer3 value < =3
6 Permitted ΔG for homo‐ or heterodimers >–5 for 3’ end dimmers
>–6 for internal homo‐ or heterodimers 		>–5 for 3’ end dimmers
>–6 for internal homo‐ or heterodimers
7 ΔG for hairpins > –2 for 3’ end hairpin
> –3 for internal hairpins 		> –2 for 3’ end hairpin
> –3 for internal hairpins
8 Max template mispriming Primer3 value = 12 for each primer Primer3 value = 12 for each primer

18.5.1 Primer3

  1. Length of primer
  2. T m (given as “tm”) and Tm difference
  3. GC%
  4. Self‐complementarity (cited as “any” in the output) and 3′ self‐Complementarity

18.5.2 Oligo analysis

  1. Mispriming
  2. GC clamp
  3. Self‐complementarity, etc.

18.6 QUESTIONS

  1. 1. Design a primer pair that will flank the region between 100 and 150 bases of the given sequence: >Test1(NCBI Acc. No. AB969677.1)

    T G G A T G A A T G A A A A G C C C T G C T T T G C A A C C C C T C A G C A T G G C A G G C C T G C A G C T C A T G A C C C C T G C T T C C T C A C C A A T G G G T C C T T T C T T T G G A C T T C C A T G G C A A C A A G A A G C A A T T C A T G A T A A C A T T T A T A C G C C A A G A A A A T A T C A G G T T G A A C T G C T T G A A G C A G C T C T G G A T C A T A A T A C C A T A G T C T G T T T A A A C A C T G G C T C A G G G A A G A C G T T T A T T G C A G T A C T A C T C A C T A A A G A G C T G T C C T A T C A G A T C A G G G G A G A C T T C A A C A G A A A T G G C A A A A G G A C G G T G T T C T T G G T C A A C T C T G C A A A C C A G G T T G C T C A A C A A G T G T C A G C T G T C A G A A C T C A C T C A G A T C T C A A G G T C G G G G A A T A C T C A A A C T T A G A A G T A A G T G C A T C T T G G A C A A A A G A G A A A T G G A A C C T A G A G T T T A C T A A A C A T C A G G T T C T C G T T A T G A C T T G C T A T G T C G C C T T G A A T G T T T T G A A A A A T G G T T A C T T A T C A C T G T C A G A C A T T A A C C T T T T G G T G T T T G A T G A G T G T C A T C T T G C A A T C C T A G A C C A C C C C T A C C G A G A A A T T A T G A A G C T T T G T G A A A A T T G T C C A T C A T G T C C T C G T A T T T T G G G A C T A A C T G C T T C C A T T T T A A A T G G G A A A T G T G A T C C A G A G G A A T T G G A A G A A A A G A T T C A G A A A C T G G A G A A A A T T C T T A A G A G T A A T G C T G A A A C T G C A A C T G A C T T G G T G G T C T T A G A C A G A T A T A C T T C T C A G C C A T G T G A G A T T G T G G T A G A C T G T G G A C C A T T T A C T G A C A G A A G T G G G C T T T A T G A A A G A C T G C T G A T G G A G T T A G A A G A A G C A C T T A A T T T T A T C A A T G A C T G T A A C A T A T C T G T A C A T T C A A A A G A A A G A G A T T C T A C T T T A A T T T C T A A A C A G A T A C T C T C A G A C T G C C G T G C G G T C C T G G T T G T C C T G G G A C C C T G G T G T G C C G A T A A A G T A G C T G G A A T G A T G G T C A G A G A G C T G C A G A A A C A C A T C A A A C A T G A G C A A G A G G A G C T G C A C C G G A A G T T T C T G T T G T T C A C A G A C A C T T T C C T A C G G A A A A T C C A C G C C C T G T G T G A A G A G C A C T T C T C C C C T G C C T C G C T T G A C C T G A A G T T T G T C A C T C C T A A A G T A A T A A A G C T G C T C G A G A T C T T A C G C A A A T A C A A A C C G T A T G A G C G G C A G C A G T T T G A A A G C G T G G A G T G G T A T A A T A A T A G G A A C C A G G A T A A T T A C G T G T C C T G G A G C G A T T C T G A G G A T G A C G A G G A A G A T G A A G A G A T T G A A G A G A A A G A A A A G C C A G A G A C A A A T T T T C C T T C T C C A T T T A C C A A T A T T T T G T G T G G A A T T A T T T T T G T G G A A A G A A G A T A C A C A G C C G T G G T C T T A A A C A G A T T G A T A A A G G A A G C T G G C A A A C A A G A T C C A G A G C T G G C T T A C A T C A G C A G C A A T T T T A T A A C T G G A C A T G G C A T C G G A A A G A A T C A G C C T C G G A A C A A A C A G A T G G A A G C A G A A T T C A G A A A G C A G G A A G A G G T A C T T A G G A A A T T T C G A G C A C A T G A A A C C A A C C T G C T T A T T G C A A C A A G T A T T G T G G A G G A G G G T G T C G A C A T A C C G A A A T G C A A C T T G G T G G T T C G T T T C G A T C T G C C C A C A G A G T A T C G A T C C T A C G T T C A G T C G A A G G G A A G A G C G A G G G C A C C C A T C T C T A A T T A T G T A A T G T T A G C A G A C A C A G A T A A A A T A A A G A G T T T T G A A G A A G A C C T T A A A A C A T A C A A A G C T A T T G A A A A G A T C T T G C G A A A C A A A T G T T C C A A G T C G G T T G A T A C C G G G G A G G C C G A C A C G G A G C C C G T G G T G G A T G A C G A C G A T G T T T T C C C A C C G T A C G T G C T G A G G C C T G A G G A C G G T C C C C G T G T C A C G A T C A A C A C A G C C A T T G G G C A T G T C A A C A G A T A C T G T G C T A G A T T A C C A A G T G A T C C A T T T A C T C A T C T G G C T C C T A A A T G T A G A A C C C G A G A G T T G C C T G A T G G T A C A T T T T A T T C A A C T C T T T A T C T G C C A A T T A A C T C A C C T C T T C

  2. 2. Design a primer pair that amplifies the conserved domain of SRY‐HMG box of Bos taurus.
  3. 3. Suppose you need to design a primer for a novel gene in buffalo. The nucleotide sequence in buffalo is not available, but it is available in taurine cattle. Write the steps you will take to design a set of primers for the target gene in buffalo.
  4. 4. For some reason, you do not have any access to the internet, and you are asked to determine the quality of a given four sets of primers (listed below) and select the best pair out of them. How will you proceed?

    TABLE 18.3

    SNPrimer5' < ‐‐‐‐‐Sequence‐‐‐‐‐ > 3'
    1Prmr1‐FACGGTCTTGGAGGCTACTCT
    2Prmr1‐RGCTCGTGATCGGACCTGTAG
    3Prmr2‐FGAATGTCGTTCCACCCAGGA
    4Prmr2‐RCCTGTGGTCGTCGTAATGCT
    5Prmr3‐FAGGAGTTATGGTTTGCCGGT
    6Prmr3‐RGCCTGGGTCGTTGTACCAAA
    7Prmr4‐FTACGTCACGATGCAAGGCAG
    8Prmr4‐RCTGTTACTAGCACTGGGCGG
  5. 5. Which parameters are the most important to select the best primer out of a set of designed primers? Elaborate with reasoning.
..................Content has been hidden....................

You can't read the all page of ebook, please click here login for view all page.
Reset